Top » Catalog » I2 » FGC56855

$18.00

FGC56855
[FGC56855]

FGC56855
hg38 Position: ChrY:16563006..16563006
Ancestral: T
Derived: A
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: I2a
Comments: Below CTS595 > FGC56815
Forward Primer: FGC56855_F CCAGCGACTGAATCTTTCTTACAC
Reverse Primer: FGC56855_R GGACTTTATTTAGAGCACACTCATATATTG
Reviews

Customers who bought this product also purchased
A10033
A10033
Y4200
Y4200
L1286
L1286
A15050
A15050
Y4252
Y4252
FGC56815
FGC56815
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies