Top » Catalog » I2 » A20948

$18.00

A20948
[A20948]

A20948
hg38 Position: ChrY:13460135..13460135
Ancestral: A
Derived: C
Reference: Alex Buchanan (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A20948_F CAATCCCTGAACCCAATTTTAG
Reverse Primer: A20948_R AATGACATGGCACCTTTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18720
$18.00
Haplogroup Info
Other products
Currencies