Top » Catalog » I2 » A20949

$18.00

A20949
[A20949]

A20949
hg38 Position: ChrY:14452001..14452001
Ancestral: T
Derived: C
Reference: Alex Buchanan (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A20949_F TTAGGGACTTGGCTCCTCAG
Reverse Primer: A20949_R TCCACAACAGCCAAACTCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies