Top » Catalog » I2 » A21204

$18.00

A21204
[A21204]

A21204
hg38 Position: ChrY:12662160..12662160
Ancestral: T
Derived: C
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments: Below CTS1758
Forward Primer: A21204_F CTGCAGCTATCCCAGTGTTG
Reverse Primer: A21204_R AGGGAGGGACTCAGAGCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y5189
$18.00
Haplogroup Info
Other products
Currencies