Top » Catalog » I2 » A21279

$18.00

A21279
[A21279]

A21279
hg38 Position: ChrY:20698680..20698680
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments: Below A5874
Forward Primer: A21279_F GGGTCCATGCCATAAGAATG
Reverse Primer: A21279_R GCAGCTAATGGCACCTCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies