Top » Catalog » I2 » A21812

$18.00

A21812
[A21812]

A21812
hg38 Position: ChrY:16311152..16311152
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2a
Comments: Below Y3118
Forward Primer: A21812_F AGGAACAAACAACTCCAGATGC
Reverse Primer: A21812_R CATAGTAGCTCTTGAAATTCATGTCATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies