Top » Catalog » I2 » A21934

$18.00

A21934
[A21934]

A21934
hg38 Position: ChrY:19280403..19280403
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2a
Comments: Below Z17855
Forward Primer: A21934_F CTGCAAAGAAACACCCTTCC
Reverse Primer: A21934_R GGAAAATAAACCAGGCACAGAG
Reviews

Customers who bought this product also purchased
BY190177
BY190177
A2512
A2512
S17250
S17250
PH3414
PH3414
CTS10228
CTS10228
A16413
A16413
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies