Top » Catalog » I2 » A22226

$18.00

A22226
[A22226]

A22226
hg38 Position: ChrY:15650109..15650109
Ancestral: C
Derived: T
Reference: John O Grady (2018)
ISOGG Haplogroup: I2
Comments: Downstream S2742
Forward Primer: A22226_F CAGCCTGGTCTCAGGAAAAC
Reverse Primer: A22226_R TCCACCCACATAAAATGCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A14973
1 x A21933
$36.00
Haplogroup Info
Other products
Currencies