Top » Catalog » I2 » A22227

$18.00

A22227
[A22227]

A22227
hg38 Position: ChrY:15996287..15996287
Ancestral: C
Derived: T
Reference: John O Grady (2018)
ISOGG Haplogroup: I2
Comments: Downstream S2742
Forward Primer: A22227_F CGAGAAACTCTGACCCTGTG
Reverse Primer: A22227_R CCATGCAAACCTGGCTATTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19478
$18.00
Haplogroup Info
Other products
Currencies