Top » Catalog » I2 » A22228

$18.00

A22228
[A22228]

A22228
hg38 Position: ChrY:16010356..16010356
Ancestral: G
Derived: T
Reference: John O Grady (2018)
ISOGG Haplogroup: I2
Comments: Downstream S2742
Forward Primer: A22228_F TTTTCCTCTGGTTCCTGCAC
Reverse Primer: A22228_R CTTTCAAGTGCTCCCCAATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A20723
$18.00
Haplogroup Info
Other products
Currencies