Top » Catalog » I2 » A22231

$18.00

A22231
[A22231]

A22231
hg38 Position: ChrY:19368972..19368972
Ancestral: C
Derived: T
Reference: John O Grady (2018)
ISOGG Haplogroup: I2
Comments: Downstream S2742
Forward Primer: A22231_F TTGCCTGGCTAAGTATGTTCC
Reverse Primer: A22231_R CCATCCAGAATGGCATAACC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies