Top » Catalog » I2 » A862

$18.00

A862
[A862]

A862
hg38 Position: ChrY:8042969..8042969
Ancestral: G
Derived: A
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: A862_F TCATATGCACACCAATCTGACC
Reverse Primer: A862_R GGCCCAGGCAAGTTACTATTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies