Top » Catalog » I2 » A866

$18.00

A866
[A866]

A866
hg38 Position: ChrY:12354809..12354809
Ancestral: G
Derived: C
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: A866_F CTTTCTACTTTTAGAGCCATTGGG
Reverse Primer: A866_R CCATACCTCAGTCAGTCAGTAAGAAC
Reviews

Customers who bought this product also purchased
A867
A867
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies