Top » Catalog » I2 » A868

$18.00

A868
[A868]

A868
hg38 Position: ChrY:14869062..14869062
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: A868_F TGTCATCAGCTAAATTCTCTTCTGAG
Reverse Primer: A868_R AAGAACATCTCTTCTGGATAGAACG
Reviews

Customers who bought this product also purchased
DC36
DC36
DC1
DC1
FGC5659
FGC5659
DC29
DC29
DC38
DC38
FGC5628
FGC5628
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies