Top » Catalog » I2 » A869

$18.00

A869
[A869]

A869
hg38 Position: ChrY:17161345..17161345
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: A869_F TGCCCTGAACTGCAAGTATG
Reverse Primer: A869_R TTAACACACATTGCATTAAATTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies