Top » Catalog » I2 » A871

$18.00

A871
[A871]

A871
hg38 Position: ChrY:19032840..19032840
Ancestral: T
Derived: A
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Below S17250
Forward Primer: A871_F CAGCATGCCAGGCTACTAGG
Reverse Primer: A871_R CATCACAACCCAGTTCAGGTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies