Top » Catalog » I2 » A22312

$18.00

A22312
[A22312]

A22312
hg38 Position: ChrY:19136399..19136399
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A22312_F TAGAGTCAGAGTCTATCAAAATGATACAG
Reverse Primer: A22312_R TGGGGAAGAGACTTATTTTCAAC
Reviews

Customers who bought this product also purchased
PH908
PH908
Y134603
Y134603
Y108172
Y108172
Y3548
Y3548
FGC14457
FGC14457
A5913
A5913
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies