Top » Catalog » I2 » A22312

$18.00

A22312
[A22312]

A22312
hg38 Position: ChrY:19136399..19136399
Ancestral: T
Derived: G
Reference: Zdenko Markovic (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A22312_F TAGAGTCAGAGTCTATCAAAATGATACAG
Reverse Primer: A22312_R TGGGGAAGAGACTTATTTTCAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x S165
$18.00
Haplogroup Info
Other products
Currencies