Top » Catalog » I2 » S6656

$18.00

S6656
[S6656]

S6656
hg38 Position: ChrY:15298848..15298848
Ancestral: G
Derived: C
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2c (not listed)
Comments: Downstream L596 > S6716 > FGC18107
Forward Primer: S6656_F TACATGCACGTGGACTCTCC
Reverse Primer: S6656_R GGTGCCTGACACACAAGATG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies