Top » Catalog » I2 » PF3892

$18.00

PF3892
[PF3892]

PF3892
hg38 Position: ChrY:8619159..8619159
Ancestral: T
Derived: C
Reference: Paolo Francalacci (2011)
ISOGG Haplogroup: I2c1
Comments: Extracted from genome study of Sardinian samples
Forward Primer: PF3892_F CACACCCCTCCCAATAACAG
Reverse Primer: PF3892_R ATCTGTATGGCCCCAGTTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies