Top » Catalog » I2 » S22288

$18.00

S22288
[S22288]

S22288
hg38 Position: ChrY:17328460..17328460
Ancestral: T
Derived: G
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2a (not listed)
Comments: Approx. hg: I2a-CTS5966
Forward Primer: S22288_F ACCTATGTTAAATAGGTGGCTCATC
Reverse Primer: S22288_R CTAACCACCCGCTGACAGA
Reviews

Customers who bought this product also purchased
S17250
S17250
Wish a SNP
Wish a SNP
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A17271
1 x A21069
1 x B268
1 x FGC7185
1 x S25733
$90.00
Haplogroup Info
Other products
Currencies