Top » Catalog » I2 » A1221

$18.00

A1221
[A1221]

A1221
hg38 Position: ChrY:16459620..16459620
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2 (not listed)
Comments: Approx. Z17855
Forward Primer: A1221v2_F AACCACAACCTTGTAGCTCATG
Reverse Primer: A1221v2_R CAGGGATACTTGCAACATCATC
Reviews

Customers who bought this product also purchased
A19454
A19454
Y59595
Y59595
Y105557
Y105557
BY190177
BY190177
BY116090
BY116090
A21934
A21934
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A19478
$18.00
Haplogroup Info
Other products
Currencies