Top » Catalog » I2 » A1221

$18.00

A1221
[A1221]

A1221
hg38 Position: ChrY:16459620..16459620
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2 (not listed)
Comments: Approx. Z17855
Forward Primer: A1221v2_F AACCACAACCTTGTAGCTCATG
Reverse Primer: A1221v2_R CAGGGATACTTGCAACATCATC
Reviews

Customers who bought this product also purchased
BY76303
BY76303
A20030
A20030
YP196
YP196
Y52621
Y52621
Y99196
Y99196
Y162454
Y162454
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies