Top » Catalog » I2 » A1221

$18.00

A1221
[A1221]

A1221
hg38 Position: ChrY:16459620..16459620
Ancestral: C
Derived: A
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2 (not listed)
Comments: Approx. Z17855
Forward Primer: A1221v2_F AACCACAACCTTGTAGCTCATG
Reverse Primer: A1221v2_R CAGGGATACTTGCAACATCATC
Reviews

Customers who bought this product also purchased
A2512
A2512
Y4460
Y4460
DNA Sample Kit
DNA Sample Kit
A16413
A16413
PH908
PH908
PH3414
PH3414
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies