Top » Catalog » I2 » A1328

$18.00

A1328
[A1328]

A1328
hg38 Position: ChrY:2783609..2783609
Ancestral: A
Derived: G
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2 (not listed)
Comments: Below Y4882 and parallel to A811
Forward Primer: A1328v2_F GAATTGCAAAAGGGCACAG
Reverse Primer: A1328v2_R ATTAGGCATTGAAGTGGGTAATG
Reviews

Customers who bought this product also purchased
A12505
A12505
A7318
A7318
Z16971
Z16971
Y5596
Y5596
Y4460
Y4460
Y3548
Y3548
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies