Top » Catalog » I2 » A1513

$18.00

A1513
[A1513]

A1513
hg38 Position: ChrY:12052803..12052803
Ancestral: C
Derived: T
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b1a (not listed)
Comments: Downstream of S2742 and S2627 Isles B-1
Forward Primer: A1513_F GATGGTGGGGGAGAGAGG
Reverse Primer: A1513_R CATGGATGGAATGAGTTTCG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies