Top » Catalog » I2 » A1514

$18.00

A1514
[A1514]

A1514
hg38 Position: ChrY:17068751..17068751
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b1a (not listed)
Comments: Downstream of S2742 and S2627 Isles B-1
Forward Primer: A1514_F CGTGACCTCTGGCTACAACC
Reverse Primer: A1514_R TGGGTAAAGCTGCAGTAAAATG
Reviews

Customers who bought this product also purchased
Y14338
Y14338
CTS4122
CTS4122
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies