Top » Catalog » I2 » A1514

$18.00

A1514
[A1514]

A1514
hg38 Position: ChrY:17068751..17068751
Ancestral: G
Derived: T
Reference: Zdenko Markovic (2014)
ISOGG Haplogroup: I2a1b1a (not listed)
Comments: Downstream of S2742 and S2627 Isles B-1
Forward Primer: A1514_F CGTGACCTCTGGCTACAACC
Reverse Primer: A1514_R TGGGTAAAGCTGCAGTAAAATG
Reviews

Customers who bought this product also purchased
FGC8393
FGC8393
FGC7126
FGC7126
A2329
A2329
CTS10228
CTS10228
Y14605
Y14605
L161.1
L161.1
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies