Top » Catalog » I2 » Y4751

$18.00

Y4751
[Y4751]

Y4751
hg38 Position: ChrY:16523842..16523842
Ancestral: A
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1a1a1a1a
Comments: Found in BIGY and is in the area of Y4750. aka FGC20065
Forward Primer: Y4751_F CTAAAACATCCCTAGGCAGGG
Reverse Primer: Y4751_R TCTGTCTCATCACTTCAGCAAAAC
Reviews

Customers who bought this product also purchased
M223
M223
Y10657
Y10657
M168
M168
Y31615
Y31615
I2 Superclade Panel
I2 Superclade Panel
I2a-M284 Panel
I2a-M284 Panel
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies