Top » Catalog » I2 » Y4751

$18.00

Y4751
[Y4751]

Y4751
hg38 Position: ChrY:16523842..16523842
Ancestral: A
Derived: G
Reference: Yfull (2014)
ISOGG Haplogroup: I2a2a1a1a1a1a
Comments: Found in BIGY and is in the area of Y4750. aka FGC20065
Forward Primer: Y4751_F CTAAAACATCCCTAGGCAGGG
Reverse Primer: Y4751_R TCTGTCTCATCACTTCAGCAAAAC
Reviews

Customers who bought this product also purchased
A260
A260
S2679
S2679
Y3685
Y3685
DF105
DF105
M96
M96
FGC15072
FGC15072
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies