Top » Catalog » I2 » S8105

$18.00

S8105
[S8105]

S8105
hg38 Position: ChrY:14082374..14082374
Ancestral: G
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2 (not listed)
Comments: .
Forward Primer: S8105_F GATGTCCACACCTCGGTGA
Reverse Primer: S8105_R TGGCCATCTGTTCCCTTTAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y6985
$18.00
Haplogroup Info
Other products
Currencies