Top » Catalog » I2 » BY141000

$18.00

BY141000
[BY141000]

BY141000
hg38 Position: ChrY:20656679..20656679
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: Below M284 > Y4750 > Y11858
Forward Primer: BY141000_F GCTGAGAGGCAGATAACTTTTCTC
Reverse Primer: BY141000_R TTTTTTACTTATAGAGCGTCCTTTTGTG
Reviews

Customers who bought this product also purchased
Y11857
Y11857
A824
A824
Y11858
Y11858
I2a-M284 Panel
I2a-M284 Panel
A10024
A10024
A7395
A7395
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x BY153008
1 x A865
1 x BY8420
$54.00
Haplogroup Info
Other products
Currencies