Top » Catalog » I2 » BY84561

$18.00

BY84561
[BY84561]

BY84561
hg38 Position: ChrY:11063901..11063901
Ancestral: G
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: Downstream Y12073
Forward Primer: BY84561_F ACTCAAGCACAGAATGGGATG
Reverse Primer: BY84561_R AGGGGGGCAACATCTCTC
Reviews

Customers who bought this product also purchased
BY110858
BY110858
BY116706
BY116706
BY112989
BY112989
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x L159
$18.00
Haplogroup Info
Other products
Currencies