Top » Catalog » I2 » S19848

$18.00

S19848
[S19848]

S19848
hg38 Position: ChrY:15413129..15413129
Ancestral: T
Derived: A
Reference: Jim Wilson (2014)
ISOGG Haplogroup: I2
Comments: Below L621
Forward Primer: S19848_F CTATTTAAATTAAAAAGTCACTCAAAAATG
Reverse Primer: S19848_R GATAATTAATCTAGGATCACTTCCGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A16450
1 x Y6647
1 x A22963
1 x A2239
$72.00
Haplogroup Info
Other products
Currencies