Top » Catalog » I2 » A22957

$18.00

A22957
[A22957]

A22957
hg38 Position: ChrY:2822957..2822957
Ancestral: G
Derived: C
Reference: Noah Meek (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A22957_F ATGTGATCCACCCACCTCAG
Reverse Primer: A22957_R AGGTGTTGGCAGGACTATGC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies