Top » Catalog » I2 » A22958

$18.00

A22958
[A22958]

A22958
hg38 Position: ChrY:2913081..2913081
Ancestral: A
Derived: C
Reference: Noah Meek (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A22958_F AGGAAGTCCAAATGTTGATAGC
Reverse Primer: A22958_R TACTGCCATTTTGTGGCAAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies