Top » Catalog » I2 » A22968

$18.00

A22968
[A22968]

A22968
hg38 Position: ChrY:14725683..14725683
Ancestral: G
Derived: A
Reference: Noah Meek (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A22968_F AAAACCTTTACCTTGCTGTATTATTTCC
Reverse Primer: A22968_R CTTACCAGAATATAGGTCCTAACACCAG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies