Top » Catalog » I2 » A22969

$18.00

A22969
[A22969]

A22969
hg38 Position: ChrY:15056999..15056999
Ancestral: T
Derived: C
Reference: Noah Meek (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A22969_F ACAGTAAAGTCCAGAGAATCTTAAATTGG
Reverse Primer: A22969_R AATGAATATAGTCCCCAACATCATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x SK1238
1 x Y7216
$36.00
Haplogroup Info
Other products
Currencies