Top » Catalog » I2 » BY111085

$18.00

BY111085
[BY111085]

BY111085
hg38 Position: ChrY:14804913..14804913
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: BY111085_F GATGGTTTCTGGGTGAAAATG
Reverse Primer: BY111085_R CAGATACAACCAACACACGTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x DYS684
1 x DYS441
$19.90
Haplogroup Info
Other products
Currencies