Top » Catalog » I2 » BY132915

$18.00

BY132915
[BY132915]

BY132915
hg38 Position: ChrY:19276650..19276650
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: .
Forward Primer: BY132915_F ATGTAATCTCAGCTACTCGAAAGCTAAG
Reverse Primer: BY132915_R TAAAATGGTCATGATTAAAAATTCAATTAAC
Reviews

Customers who bought this product also purchased
Prepaid Return Envelope
Prepaid Return Envelope
BY32428
BY32428
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A17415
1 x A2329
1 x S8105
$54.00
Haplogroup Info
Other products
Currencies