Top » Catalog » I2 » A23502

$18.00

A23502
[A23502]

A23502
hg38 Position: ChrY:19588250..19588250
Ancestral: T
Derived: C
Reference: Antonios Kollias (2018)
ISOGG Haplogroup: I2
Comments: Below Y3120
Forward Primer: A23502_F TTGCCCTCAGTGTTTCATCC
Reverse Primer: A23502_R GGTGACAGGGAAAGACCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A11471
1 x A2423
$36.00
Haplogroup Info
Other products
Currencies