Top » Catalog » I2 » BY92246

$18.00

BY92246
[BY92246]

BY92246
hg38 Position: ChrY:11884282..11884282
Ancestral: C
Derived: T
Reference: FTDNA (2018)
ISOGG Haplogroup: I2a
Comments: Below CTS10228 > A20030
Forward Primer: BY92246_F AGAAATGCATTGAGAAGAATCATTTATC
Reverse Primer: BY92246_R GTATTCCAGGAGCCTGCTTG
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x P216
1 x A22312
1 x A18005
1 x FGC37851
1 x FGC12805
1 x FGC48150
$108.00
Haplogroup Info
Other products
Currencies