Top » Catalog » I2 » BY97805

$18.00

BY97805
[BY97805]

BY97805
hg38 Position: ChrY:12713456..12713456
Ancestral: A
Derived: G
Reference: FTDNA (2018)
ISOGG Haplogroup: I2a
Comments: Below CTS10228 > A20030
Forward Primer: BY97805_F ACAGACAAAAGCCACTGTGC
Reverse Primer: BY97805_R TGAAACATGCTACAGGCAAAC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x Y5751
1 x BY1445
$36.00
Haplogroup Info
Other products
Currencies