Top » Catalog » I2 » A23881

$18.00

A23881
[A23881]

A23881
hg38 Position: ChrY:21107391..21107391
Ancestral: C
Derived: A
Reference: Zivota Selakovic (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A23881_F CTCTCAGGGAGATGGCAGAG
Reverse Primer: A23881_R GCTTGGTCAAACTCTGGCTTC
Reviews

Customers who bought this product also purchased
A23882
A23882
Y47407
Y47407
A23880
A23880
BY182386
BY182386
A23879
A23879
A23885
A23885
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies