Top » Catalog » I2 » A23882

$18.00

A23882
[A23882]

A23882
hg38 Position: ChrY:7008002..7008002
Ancestral: A
Derived: C
Reference: Zivota Selakovic (2018)
ISOGG Haplogroup: I2
Comments:
Forward Primer: A23882_F GCGTGCTGGAATTATATGCG
Reverse Primer: A23882_R TGACCTCTGGATACAATGGC
Reviews

Customers who bought this product also purchased
A23884
A23884
A23883
A23883
A23881
A23881
Y47407
Y47407
A23880
A23880
BY182386
BY182386
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies