Top » Catalog » I2 » BY169307

$18.00

BY169307
[BY169307]

BY169307
hg38 Position: ChrY:7776993..7776993
Ancestral: A
Derived: C
Reference: FTDNA (2018)
ISOGG Haplogroup: I2
Comments: Downstream A1328
Forward Primer: BY169307_F CCAAAGACACTAATGATTGGATTC
Reverse Primer: BY169307_R CTTGCAGTGAGCCGAGATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies