Top » Catalog » I2 » F2044

$18.00

F2044
[F2044]

F2044
hg38 Position: ChrY:13832720..13832720
Ancestral: T
Derived: A
Reference: Yan Shi (2011)
ISOGG Haplogroup: I2c1a2a1a1a
Comments: Found in a hg D person. Downstream of F853. Also I2
Forward Primer: F2044_F AACTCCGGACCCACCATC
Reverse Primer: F2044_R GCAACTGGGAGTTAAGGCTTC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A7719
1 x A11214
$36.00
Haplogroup Info
Other products
Currencies