Top » Catalog » J1 » BY117385

$18.00

BY117385
[BY117385]

BY117385
hg38 Position: ChrY:15677936..15677936
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: Below Y113483
Forward Primer: BY117385_F TGGGTCTTTCCAATGATGTTC
Reverse Primer: BY117385_R CACTGGAATGTGAACCTGAGAC
Reviews

Customers who bought this product also purchased
S15852
S15852
ZS10317
ZS10317
BY75
BY75
ZS2373
ZS2373
V1662
V1662
ZS2374
ZS2374
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies