Top » Catalog » J1 » BY117385

$18.00

BY117385
[BY117385]

BY117385
hg38 Position: ChrY:15677936..15677936
Ancestral: C
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: Below Y113483
Forward Primer: BY117385_F TGGGTCTTTCCAATGATGTTC
Reverse Primer: BY117385_R CACTGGAATGTGAACCTGAGAC
Reviews

Customers who bought this product also purchased
ZS2373
ZS2373
V1662
V1662
ZS2374
ZS2374
ZS10316
ZS10316
J1-ZS2374 Panel
J1-ZS2374 Panel
S15852
S15852
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC10416
1 x FGC6525
1 x FGC38711
1 x FGC10422
1 x FGC4338
1 x BY145
1 x A18553
1 x FGC1722
1 x FGC23929
1 x FGC5428
1 x FGC22248
1 x FGC8716
1 x FGC19506
$234.00
Haplogroup Info
Other products
Currencies