Top » Catalog » J1 » FGC47437

$18.00

FGC47437
[FGC47437]

FGC47437
hg38 Position: ChrY:16655443..16655443
Ancestral: T
Derived: C
Reference: Full Genomes Corp. (2016)
ISOGG Haplogroup: J1
Comments: Below L859
Forward Primer: FGC47437_F TCTTCCATAATGGTTGAATTAATTGG
Reverse Primer: FGC47437_R ATCACGAGGCCAGGAGATC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A12919
1 x A13638
1 x FGC22257
1 x FGC1
1 x A17829
1 x FGC4493
1 x B233
1 x BY169067
1 x CTS7188
1 x FGC33172
1 x A19929
1 x BY13788
1 x FGC49261
1 x ALK576
$252.00
Haplogroup Info
Other products
Currencies