Top » Catalog » J1 » BY81893

$18.00

BY81893
[BY81893]

BY81893
hg38 Position: ChrY:10061452..10061452
Ancestral: G
Derived: A
Reference: FTDNA (2018)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: BY81893_F GACCTCATTCCTATAAAAAATCTAAAAAATG
Reverse Primer: BY81893_R TCTTTTGCTGTACAGAAGCTCTTTAG
Reviews

Customers who bought this product also purchased
BY53798
BY53798
FGC87927
FGC87927
FGC87926
FGC87926
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies