Top » Catalog » J1 » BY74

$18.00

BY74
[BY74]

BY74
hg38 Position: ChrY:6895193..6895193
Ancestral: A
Derived: G
Reference: FTDNA
ISOGG Haplogroup: J1a (not listed)
Comments: Below Z640
Forward Primer: BY74_F GAAAATCTAGATAGACACCAACAAAAGC
Reverse Primer: BY74_R GTAAGGAGTCCTTGATGTCTTGC
Reviews

Customers who bought this product also purchased
Y91969
Y91969
FGC68006
FGC68006
P58
P58
ZS6362
ZS6362
PF4881
PF4881
Z2324
Z2324
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
0 items
Haplogroup Info
Other products
Currencies