Top » Catalog » J1 » BY74

$18.00

BY74
[BY74]

BY74
hg38 Position: ChrY:6895193..6895193
Ancestral: A
Derived: G
Reference: FTDNA
ISOGG Haplogroup: J1a (not listed)
Comments: Below Z640
Forward Primer: BY74_F GAAAATCTAGATAGACACCAACAAAAGC
Reverse Primer: BY74_R GTAAGGAGTCCTTGATGTCTTGC
Reviews

Customers who bought this product also purchased
HU33
HU33
ZS1426
ZS1426
BY92
BY92
YSEQ-Alpha-Beta
YSEQ-Alpha-Beta
Y72854
Y72854
FGC41680
FGC41680
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x A18932
1 x FGC5
1 x A22918
1 x ALK341
$72.00
Haplogroup Info
Other products
Currencies