Top » Catalog » J1 » FGC43123

$18.00

FGC43123
[FGC43123]

FGC43123
hg38 Position: ChrY:13202058..13202058
Ancestral: T
Derived: C
Reference: Full Genomes Corp (2016)
ISOGG Haplogroup: J1
Comments: .
Forward Primer: FGC43123_F AAGCAGAGGTTGCAGTGAGAC
Reverse Primer: FGC43123_R CCCCCACTTCCTACTCTTCC
Reviews
Categories
Haplogroups
Quick Find
 
Use keywords to find the product you are looking for.
Advanced Search
1 x FGC38645
1 x FGC4295
1 x FGC11723
1 x FGC16666
1 x FGC5225
1 x ALK358
1 x FGC5241
1 x CTS5551
1 x FGC29872
1 x BY13781
1 x A22922
1 x ALK534
1 x ALK870
1 x FGC50913
1 x FGC4347
1 x A14645
1 x ALK327
1 x ALK759
1 x FGC1707
$342.00
Haplogroup Info
Other products
Currencies